Oligo Business Division 


Macrogen offers an oligo synthesis service on various scales using high-quality raw materials and an optimised process. The synthesized oligos are used in various biology and medical fields such as DNA sequencing, PCR, SNP study, gene synthesis, NGS service, qPCR service, biochip and siRNA expression.

Macrogen uses 1000Å CPG to provide high-quality oligos, and offers independently developed MOPC purification for all oligos as a default option. MOPC purification, a cartridge purification method, has efficiency similar to that of HPLC and PAGE purification. MALDI-TOF is used for thorough quality control of all oligos, and result reports are provided with the synthesised oligos.

All processes of the oligo service of Macrogen, including synthesis, purification and dispensing, are performed by automated equipment, which enables more accurate dispensing, and a more convenient test environment is provided based on the standardised service. It is possible to monitor the entire process from online order to oligo synthesis, confirmation of results, and delivery with Macrogen’s own Laboratory Information Management System (LIMS).

Custom DNA Oligos


Macrogen provides the best oligo synthesis service with the latest equipment and an automated system.
High-quality oligos are produced via a purification process by removing impurities and oligos that are non-specifically bound. The quality of all oligos is controlled by MALDI-TOF mass spectrometry.

Features

  • Scales from 0.025 µmole to 1 µmole
  • Quick delivery by express courier (using FedEx / DHL International shipping)
  • Accurate concentration provided by the liquid handling system
  • Orders, progress of synthesis, delivery, and results of synthesis can be confirmed by Laboratory Information Management System (LIMS)
  • Duplex oligos (double-stranded oligos) are possible
  • Free shipping: ≥ 300 bases of primers

Guaranteed Yield

Standard oligos can be synthesised for 3 ~ 130 mer
For modified oligos, up to 60 mer is recommended (Inquire for oligos of 60 mer or more)

Guaranteed Yield (OD) Synthesis Scale
0.025 0.05 0.2 1
Desalt 3
MOPC 6 8 20
PAGE 2 4 8
HPLC 2 4 8

Oligo Synthesis Purification

Salt Free (Desalt) MOPC (Macrogen Oligonucleotide

Purification Cartridge)

HLPC PAGE
  • Available for unmodified oligos (0.025 µmole)
  • Length from 3~35 mer
  • Available for both standard oligos and some modified oligos
  • Purity of ≥85% (LC analysis)
  • Available for free as a default for all oligos
  • Available for all standard oligos and modified oligos
  • Recommended for oligos of 50 mer or less
  • Purity of ≥ 90% (LC analysis)
  • Available for all standard oligos and modified oligos
  • Recommended for oligos of 50 mer or less
  • Purity of ≥95% (LC analysis)

100% QC

Release and delivery of synthesised oligos occur after OD measurement and MALDI-TOF MS analysis to ensure quality. The resulting report is shipped with the ordered oligos.

The MALDI-TOF molecular weight analysis method, which is more accurate than PAGE gel QC, is used as the quality-check method for oligos and precisely analyses oligos containing N-1 and N-2.

Oligo Modification


Various types of modification oligo synthesis services are provided using high-quality raw materials and optimized processes. HPLC and PAGE purification are available with the option of various scales.

Fluorescent dyes FAM,HEX,TET,JOE, TAMRA, CY3, CY5, CY3.5, CY5.5
CAL Fluor560
ATTO565 NHS-ester, ROX NHS-ester, TexasRed NHS-ester
Non-fluorescent modifications Phosphorylatioin, Biotin, NH2C6, NH2C12, C3 Spacer, dSpacer
Thiol C6 S-S
Dark quenchers Black Hole Quencher(BHQ1, BHQ2, BHQ3)
Blackberry Quencher(BBQ650)
Dabcyl and Eclipes quencher
Internal modification DeoxyInosine (dI)

Dual-labelled DNA Probes


5′ Fluorophore 3′ Quencher
FAM TAMRA, BHQ1, Dabcyl
HEX TAMRA, BHQ1, BHQ2, Dabcyl
TET TAMRA, BHQ1, BHQ2, Dabcyl
JOE TAMRA, BHQ1, BHQ2, Dabcyl
CY3 BHQ1, BHQ2, BHQ3
CY3.5 BHQ2
CY5 BHQ2, BHQ3
 CY5.5  BHQ2, BHQ3, BBQ650
TAMRA BHQ1
ATTO565 NHS-ester BHQ1, BHQ2, BBQ650
ROX NHS-ester TAMRA, BHQ2, BBQ650
TexasRed NHS-ester BHQ1, BHQ2, BBQ650

Premade Oligos


Premade ologos

Premade oligo is prepared to be provided immediately when customers order oligos suitable for their various research purposes.

Features

  •  5nmol of ≥ 95% pure primer (PAGE purification).
  •  MALDI-TOF QC
  •  Confirms purification by HPLC
  •  70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers

Premade Oligos List


Primer for Sequencing

Primer Name Sequence Base
a-Factor TACTATTGCCAGCATTGCTGC 21
AD Reverse AGATGGTGCACGATGCACAG 20
AOX1 Forward GACTGGTTCCAATTGACAAGC 21
AOX1 Reverse GCAAATGGCATTCTGACATCC 21
BGH-R TAGAAGGCACAGTCGAGG 18
Bluescript SK CGCTCTAGAACTAGTGGATC 20
Bluescript KS TCGAGGTCGACGGTATC 17
CMV-F CGCAAATGGGCGGTAGGCGTG 21
CYC1 Reverse GCGTGAATGTAAGCGTGAC 19
DsRed1-C AGCTGGACATCACCTCCCACAACG 24
DsRed1-N GTACTGGAACTGGGGGGACAG 21
EBV-RP GTGGTTTGTCCAAACTCATC 20
EGFP-N CGTCGCCGTCCAGCTCGACCAG 22
EGFP-C CATGGTCCTGCTGGAGTTCGTA 22
EGFP-CF AGCACCCAGTCCGCCCTGAGC 21
EGFP-CR CGTCCATGCCGAGAGTG 17
EGFP-NR CGTCGCCGTCCAGCTC 16
GAL1-Forward AATATACCTCTATACTTTAACGTC 24
Gal4AD TACCACTACAATAGGATG 17
GAL1 Forward TGTATCTTATGGTACTAACTG 23
GaL4AD TACCACTACAATGGATG 17
GLprimer1 TGTATCTTATGGTACTGTAACTG 23
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA 23
LCO1490 GGTCAACAATCATAAAGATATTGG 25
HCO2198 TAACTTCAGGGTGACCAAAAAATCA 26
KAN2-FP ACCTACAACAAAGCTCTCATCAACC 25
KAN2-RP GCAATGTAACATCAGAGATTTTGAG 25
M13F-pUC(-40) GTTTTCCCAGTCACGAC 17
M13R-pUC(-40) CAGGAAACAGCTATGAC 17
M13F GTAAAACGACGGCCAGT 17
M13R GCGGATAACAATTTCACACAGG 22
M13FP TGTAAAACGACGGCCAGT 18
MT Forward CATCTCAGTGCAACTAAA 18
pGEX5 GGCAAGCCACGTTTGGTG 18
pGEX3 GGCAAGCCACGTTTGGTG 20
pMaIE TCAGACTGTCGATGAAGC 18
Primer Name Sequence Base
pQE-F CCCGAAAAGTGCCACCTG 18
pQE-R GTTCTGAGGTCATTACTGG 19
pBAD-F ATGCCATAGCATTTTTATCCA 21
pBAD-FP ATGCCATAGCATTTTTATCC 20
pBAD-R GATTTAATCTGTATCAGG 18
pTrcHis Forward GAGGTATATATTAATGTATCG 21
pJET1.2F CGACTCACTATAGGGAGAGCGGC 23
pJET1.2R AAGAACATCGATTTTCCATGGCAG 24
pEGFP_N CCGTCCAGCTCGACCAG 17
pEGFP-FP TTTAGTGAACCGTCAGATC 19
pEGFP-RP AACAGCTCCTCGCCCTTG 18
pBacPAC-RP GTCTGTAAATCAACAACGC 19
pDONOR-FP TAACGCTAGCATGGATCTC 19
pESP-RP TCCAAAAGAAGTCGAGTGG 19
pET-24a GGGTTATGCTAGTTATTGCTCAG 23
pET-RP CTAGTTATTGCTCAGCGG 18
pREP-fwd GCTCGATACAATAAACGCC 19
pRH Forward CTGTCTCTATACTCCCCTATAG 22
pRH Reverse CAAAATTCAATAGTTACTATCGC 23
RVprimer3 CTAGCAAAATAGGCTGTCCC 20
RVprimer4 GACGATAGTCATGCCCCGCG 20
SP6 ATTTAGGTGACACTATAG 18
SV40-pArev CCTCTACAAATGTGGTATGG 20
SV40-Promoter GCCCCTAACTCCGCCCATCC 20
STag 18mer Primer GAACGCCAGCACATGGAC 18
QE Promoter CCGAAAAGTGCCACCTG 17
T3 ATTAACCCTCACTAAAG 17
T7terminator GCTAGTTATTGCTCAGCGG 19
T7promoter TAATACGACTCACTATAGGG 20
T7 EEV ATGTCGTAATAACCCCGCCCCG 22
T7 AATACGACTCACTATAG 17
U-19mer Primer GTTTTCCCAGTCACGACGT 19
35S-A AAGGGTCTTGCGAAGGATAG 20
35S-B AGTGGAAAAGGAAGGTGGCT 20
Primer Name Sequence Base
pQE-F CCCGAAAAGTGCCACCTG 18
pQE-R GTTCTGAGGTCATTACTGG 19
pBAD-F ATGCCATAGCATTTTTATCCA 21
pBAD-FP ATGCCATAGCATTTTTATCC 20
pBAD-R GATTTAATCTGTATCAGG 18
pTrcHis Forward GAGGTATATATTAATGTATCG 21
pJET1.2F CGACTCACTATAGGGAGAGCGGC 23
pJET1.2R AAGAACATCGATTTTCCATGGCAG 24
pEGFP_N CCGTCCAGCTCGACCAG 17
pEGFP-FP TTTAGTGAACCGTCAGATC 19
pEGFP-RP AACAGCTCCTCGCCCTTG 18
pBacPAC-RP GTCTGTAAATCAACAACGC 19
pDONOR-FP TAACGCTAGCATGGATCTC 19
pESP-RP TCCAAAAGAAGTCGAGTGG 19
pET-24a GGGTTATGCTAGTTATTGCTCAG 23
pET-RP CTAGTTATTGCTCAGCGG 18
pREP-fwd GCTCGATACAATAAACGCC 19
pRH Forward CTGTCTCTATACTCCCCTATAG 22
pRH Reverse CAAAATTCAATAGTTACTATCGC 23
RVprimer3 CTAGCAAAATAGGCTGTCCC 20
RVprimer4 GACGATAGTCATGCCCCGCG 20
SP6 ATTTAGGTGACACTATAG 18
SV40-pArev CCTCTACAAATGTGGTATGG 20
SV40-Promoter GCCCCTAACTCCGCCCATCC 20
STag 18mer Primer GAACGCCAGCACATGGAC 18
QE Promoter CCGAAAAGTGCCACCTG 17
T3 ATTAACCCTCACTAAAG 17
T7terminator GCTAGTTATTGCTCAGCGG 19
T7promoter TAATACGACTCACTATAGGG 20
T7 EEV ATGTCGTAATAACCCCGCCCCG 22
T7 AATACGACTCACTATAG 17
U-19mer Primer GTTTTCCCAGTCACGACGT 19
35S-A AAGGGTCTTGCGAAGGATAG 20
35S-B AGTGGAAAAGGAAGGTGGCT 20

Primer for Microbe Identification

Primer Name Sequence Base
27F AGAGTTTGATCMTGGCTCAG 20
337F GACTCCTACGGGAGGCWGCAG 21
518F CCAGCAGCCGCGGTAATACG 20
785F GGATTAGATACCCTGGTA 18
800R TACCAGGGTATCTAATCC 18
907R CCGTCAATTCMTTTRAGTTT 20
1100R GGGTTGCGCTCGTTG 15
1492R TACGGYTACCTTGTTACGACTT 22
NS1 GTAGTCATATGCTTGTCTC 19
NS8 TCCGCAGGTTCACCTACGGA 20
LR0R ACCCGCTGAACTTAAGC 17
LR7 TACTACCACCAAGATCT 17
ITS1 TCCGTAGGTGAACCTGCGG 19
ITS2 GCTGCGTTCTTCATCGATGC 20
ITS3 GCATCGATGAAGAACGCAGC 20
ITS4 TCCTCCGCTTATTGATATGC 20
ITS5 GGAAGTAAAAGTCGTAACAAGG 22

Random Primer

Primer Name Sequence Base
Oligo dT(15) TTTTTTTTTTTTTTT 15
Oligo dT(18) TTTTTTTTTTTTTTTTTT 18
Oligo dT(20) TTTTTTTTTTTTTTTTTTTT 20
Random Hexamer NNNNNN 6
Random Nonamer NNNNNNNNN 9

Gene Synthesis Service


The gene synthesis service synthesises genes according to the customer’s gene sequence order. It is widely used in areas where recombinant DNA is studied, such as vaccine manufacturing, gene treatment and character expression.

Macrogen’s gene synthesis service provides synthesis services for genes in a plasmid DNA state with a free cloning service, as well as DNA sequencing. Customers can use a wider range of synthesis services via the mutagenesis service. Moreover, a 100% sequence is guaranteed based on ABI 3730xl sequencing equipment, and convenient ordering and inquiries for quotations are possible through the Laboratory Information Management System (LIMS).

Features

  •  Free cloning service (Macrogen standard vector)
  •  100% sequence guaranteed using ABI 3730xl
  •  Mutagenesis service available
  •  Provided as plasmid DNA
  •  Free sequencing provided
  •  Quotation inquiries and orders possible using Laboratory Information Management System (LIMS)
Gene Synthesis

© 2017 - 2019 Macrogen Oceania